Diablogs
Would Darwin Tweet?
April 29, 2009
Darwin considered his 500 page book On the Origin of Species “an abstract” of a much longer “essay” he was preparing. It doesn’t seem that he would have much use for the micro-blog website Twitter!
How briefly can you summarize Darwin’s big idea: evolution through natural selection? Give it a try in the comments below. (If you can do it in 140 characters or less, let us know @APS_Museum.)
Post a new comment
Commenting is not available in this weblog entry.Any views and opinions expressed by the participants in this discussion forum are not endorsed by and do not necessarily represent the views of the American Philosophical Society and the Philadelphia Area Center for History of Science. User comments that include profanity or personal attacks or other inappropriate or repetitious comments may be removed from the site. We reserve the right to moderate the comments; therefore, the comments may not appear immediately. We reserve the right to block users who violate any of our posting standards.
User Comments
Submitted by karenj on Friday, May 01, 2009, at 9:14am
The bar is set by Dawkins, who wrote in The Selfish Gene that evolution is “the outcome of non-random survival of randomly varying replicators”.
This is not only brief but it incorporates all four pillars of Darwin’s conception of evolution by natural selection, that is:
1. more individuals are born than survive
2. struggle for survival
3. variation and inheritance
4. natural selection (modeled after artificial selection)
Thus:
“non-random survival” = 1 + 2 + 4
“randomly varying replicators” = 3
My hat will go off to anyone who can top that!
Submitted by Sylwester Ratowt on Friday, May 01, 2009, at 9:53am
RT @AlexanderJBruno Genetic mutations may better survival chances in an environment & some offspring inherit good mutations via reproduction
Submitted by Sylwester Ratowt on Friday, May 01, 2009, at 9:56am
RT @crc2008 “Evolution= fit for purpose, genes changed by chance?”
Submitted by Sylwester Ratowt on Friday, May 01, 2009, at 9:57am
RT @crc2008 “Evolution= Shift happens, in generations”?
Submitted by Sylwester Ratowt on Friday, May 01, 2009, at 10:16am
RT @jrblackwell Choice equals Change.
Submitted by Sylwester Ratowt on Friday, May 01, 2009, at 10:18am
RT @tlemberger #hdf (heritable differential survival) ?
Submitted by jas3 on Monday, May 04, 2009, at 10:20am
When GCGTGCATGCACTTGCAGTGACGGCCGTGGACAGCGGGAAGAGGGC outcompetes GCGTGCATGCACTTGCAGTGACGGCCGTGGACAGCGGGAAGAGGGG, the latter will eventually replace the former.
Submitted by Nightbreaker on Monday, May 04, 2009, at 5:44pm
underlying darwin’s evolution there are logical problems:
1. information (DNA) resulting from chaos
2. reason coming from non-reason
3. randomness = refinement
4. conservation as a creative force.
Submitted by Sylwester Ratowt on Monday, May 11, 2009, at 7:25am
@Richard_Dawkins “Random mutation, non-random selection."- Richard Dawkins. “Variation and elimination."- Ernst Mayr
Submitted by Bonnie on Thursday, May 14, 2009, at 1:44pm
Change happens.
Nature chooses.
Some survive.
Submitted by Lauren M on Friday, October 16, 2009, at 2:58pm
No I think he would be to busy studying nature to waste time behind a computer